Toggle Accessibility Tools

Illumina Sequencing Sample Requirements

The MSU Genomics Core accepts user-prepared libraries and prepares Illumina-compatible DNA-seq, RNA-seq, and amplicon libraries.  The requirements for these services are listed in the tables below.

The quantities specified below apply to samples that have been quantified by a fluorometric method, such as Qubit or PicoGreen. The Genomics Core has a Qubit 1.0 and FLUOstar OPTIMA microplate reader available to users for quantification.  Please see the Common Use Equipment Room webpage to reserve a time to use the shared equipment.

If your samples do not meet the sample submission requirements, please contact the Genomics Core (gtsf@msu.edu) to discuss your specific situation.

User Prepared Library Requirements

DNA Requirements

RNA Requirements

Amplicon/Metagenomic Requirements


User Prepared Library Requirements

Submit libraries in nuclease-free water, Qiagen EB buffer, or 10mM Tris, 0.1% Tween20. Submit libraries in 1.5 ml microcentrifuge tubes, tightly sealed and clearly labeled with the sample name on the top and side of tube. 

Instrument Average Library Size Minimum Concentration Minimum Volume
HiSeq 4000 ≤ 550 bp 10 nM 15 µl
NextSeq 500 ≤ 900 bp 10 nM 15 µl
MiSeq ≤ 900 bp 10 nM 15 µl

DNA Requirements

Submit DNA in nuclease-free water, Qiagen EB buffer, or 10mM Tris pH 8.0. All DNA must be RNase-treated. 

Library Kit Name Use Quantity Concentration Volume
Illumina TruSeq Nano DNA Library Prep Kit1 Shotgun DNA Library Preparation ≥ 500 ng preferred, 300 ng minimum ≥ 15 ng/µl ≥ 20 µl
TakaraBio SMARTer ThruPLEX DNA-Seq Kit1 Low Input DNA Library Preparation ≥ 50 ng preferred, 20 ng minimum ≥ 1 ng/µl ≥ 20 µl
TakaraBio SMARTer ThruPLEX DNA-Seq Kit2 ChIP-seq Library Preparation ≥ 50 ng preferred, 20 ng minimum3 ≥ 1 ng/µl ≥ 20 µl
Swift BioSciences Accel-NGS Methyl-Seq DNA Library Prep Kit4 Methyl-Seq DNA Library Preparation. Whole Genome Bisulfite Sequencing (WGBS) and Reduced Representation Bisulfite Sequencing (RRBS) are possible.  Contact the Genomics Core to discuss RRBS. Bisulfite conversion performed using Zymo EZ DNA Methylation-Gold Kit. ≥ 2 µg preferred, 1 µg minimum ≥ 50 ng/µl  ≥ 20 µl

Genomic DNA must be high molecular weight and pure.  Genomic DNA should be run on a gel to confirm integrity, please provide gel image at the time of submission.

Average length of DNA fragments must be ≤ 450 bp.  Provide TapeStation trace (or equivalent) at the time of submission to confirm size.

If ChIP samples do not meet the requirements listed, please contact the Genomics Core (gtsf@msu.edu) prior to sample submission.

Genomic DNA must be high molecular weight and pure.  Genomic DNA should be run on a gel to confirm integrity.  Please provide gel image at the time of submission.


RNA Requirements

Submit RNA in nuclease-free water, Qiagen EB Buffer, or 10mM Tris pH 8.0. All total RNA samples must be DNA-free. RNA extraction protocols using TRIzol are not recommended. A TapeStation trace or equivalent (such as Bioanalyzer) must be submitted with samples. Bioanalyzer RIN or TapeStation RINe scores of 8.0 or greater are recommended for non-plant samples and for non-photosynthetic plant samples.  For photosynthetic plant samples that are run on the Bioanalyzer, RIN scores of 7.0 or greater are recommended.  However, for photosynthetic plant samples that are run on the TapeStation, plastid rRNAs confound the TapeStation algorithm that calculates the RINe score, and RINe scores of about 5.0 may still represent largely intact RNA.   Questionable TapeStation results from photosynthetic plant samples should be sent to the Genomics Core (gtsf@msu.edu) for review.  See this Agilent Application Note for a description of the complications from plastid rRNA. 

Library Kit Name Use Quantity Concentration Minimum Volume
Illumina TruSeq Stranded mRNA Library Prep Kit5 Library preparation of poly-adenylated mRNA ≥ 2 µg total RNA preferred, 1 µg total RNA minimum ≥ 50 ng/µl ≥ 20 µl
Illumina TruSeq Stranded Total RNA Library with Ribo-Zero Depletion6 Total RNA library preparation incorporating Ribo-Zero depletion to remove ribosomal RNA. ≥ 3 µg total RNA preferred, 1.5 µg total RNA minimum ≥ 75 ng/µl ≥ 20 µl
Lexogen QuantSeq 3' mRNA-Seq Library Prep Kit FWD for Illumina Quant-Seq generates highly strand-specific libraries of reads from the 3' end of each mRNA in your sample. Only one read is created from each mRNA, and many fewer reads are required for gene expression analysis. ≥ 2 µg total RNA preferred, 1 µg total RNA minimum ≥ 200 ng/µl7 ≥ 15 µl
Illumina TruSeq Small RNA Library Prep Kit Library preparation of microRNA between 22 and 30 nt. ≥ 2 µg total RNA preferred, 1.5 µg total RNA minimum ≥ 200 ng/µl8 15 µl
Illumina TruSeq Small RNA Library Prep Kit Library preparation of small RNAs > 30 nt.  Contact the Genomics Core to discuss project in advance. ≥ 2 µg total RNA preferred, 1.5 µg total RNA minimum ≥ 200 ng/µl8 15 µl

Appropriate for high quality, eukaryotic total RNA samples.

May be used for low quality (e.g. partially degraded) eukaryotic RNA, or when you wish to capture ncRNA along with mRNA.  These kits are species specific.  These sample requirements are for human, mouse, rat, and plant samples.  Please contact the Genomics Core to discuss your project and availability.

The Lexogen QuantSeq 3' mRNA-Seq Library Prep Kit FWD for Illumina uses a maximum input of 5 µl, therefore it is essential that samples are provided at the correct concentration.

The Illumina TruSeq Small RNA Library Prep Kit uses a maximum of 5 µl total RNA, therefore it is essential that samples are provided at the correct concentration.


Amplicon/Metagenomics Requirements

The table below provides an overview of the submission requirements for 16S-V4, 16S-V3V4, and all other amplicons. Additional requirements are provided below the table.

 
Target Input Concentration Minimum Volume Multiplex Notes
16S-V4 Metagenomic DNA 1 ng/µl minimum 10 µl up to 576 samples (dual-indexes) Test amplification and gel image required, see below for more details.
16S-V3V4 Metagenomic DNA 1 ng/µl minimum 10 µl up to 96 samples (single indexes) Test amplification and gel image required, see below for more details.
Other Primary PCR product 1 ng/µl minimum 10 µl up to 576 samples (dual-indexes) Gel image required, see below for more details.

16S-V4 Amplicons

The library preparation for the 16S-V4 region employ a one-step PCR method using the primer pair 515f/806r:

16S V4 forward (515f): GTGCCAGCMGCCGCGGTAA
16S V4 reverse (806r): GGACTACHVGGGTWTCTAAT

The submitter is required to:

  • Quantify samples via fluorometric method (such as Qubit or PicoGreen) and normalize all samples to approximately the same concentration.
  • Perform a test amplification using the 16S-V4 primers (above) to confirm the sample can be amplified and that the product is the expected size. A ladder must be run alongside the samples so that the PCR products can be sized. The gel must be run long enough to have good separation of the ladder.  The gel image(s) must be provided at the time of submission. 
  • Submit samples in a 96-well PCR-type plate, filled by column, starting with A1.

The Genomics Core will use 1 µl of genomic DNA for the amplicon library preparation.  Therefore, it is recommended that test amplifications be performed using a protocol similar to the Genomics Core's amplicon library preparation protocol.  Please see the Amplicon/Metagenomic Guide webpage for the recommended PCR reaction recipe and cycling conditions.
 

16S-V3V4 Amplicons

The library preparation for the 16S-V3V4 region employs a one-step PCR method using the primer pair 341f/806r:

16S V3 forward (341f): CCTACGGGAGGCAGCAG
16S V4 reverse (806r): GGACTACHVGGGTWTCTAAT

The submitter is required to:

  • Quantify samples via fluorometric method (such as Qubit or PicoGreen) and normalize all samples to approximately the same concentration.
  • Perform a test amplification using the 16S-V3V4 primers (above) to confirm the sample can be amplified and that the product is the expected size. A ladder must be run alongside the samples so that the PCR products can be sized. The gel must be run long enough to have good separation of the ladder.  The gel image(s) must be provided at the time of submission. 
  • Submit samples in a 96-well PCR-type plate, filled by column, starting with A1.

The Genomics Core will use 1 µl of genomic DNA for the amplicon library preparation.  Therefore, it is recommended that test amplifications be performed using a protocol similar to the Genomics Core's amplicon library preparation protocol.  Please see the Amplicon/Metagenomic Guide webpage for the recommended PCR reaction recipe and cycling conditions.

 

Other Amplicons (index adapters added by MSU Genomics Core)

For all other amplicon sequencing, a two-step PCR approach is used.  The first PCR uses target-specific primers with tags on the 5’ ends that allow us to do a second PCR for barcoding.  The submitter is required to perform the primary PCR reaction.  To do this, the submitter will need to order primers with the following tags on the 5’ ends, with the target-specific forward and reverse sequences inserted in [TS-For] and [TS-Rev], respectively:

CS1-TS-F: 5’ – ACACTGACGACATGGTTCTACA – [TS-For] – 3’
CS2-TS-R: 5’ – TACGGTAGCAGAGACTTGGTCT – [TS-Rev] – 3’

When choosing primers for a targeted amplicon it is recommended that the product amplified is less than 400bp (not including the 44bp added by the CS1/CS2 overhangs). This size will permit adequate overlap of the forward and reverse read 3' ends when sequencing with a 2x250bp format.

The Genomics Core will use 1 µl of primary PCR product for the amplicon indexing.

The submitter is required to:

  • Quantify samples via fluorometric method (such as Qubit or PicoGreen) and normalize all samples to approximately the same concentration.
  • Run products on a gel to confirm the amplification was successful, the products are the expected size, and that off-target products (including primer-dimer) are not present. A ladder must be run alongside the samples so that the PCR products can be sized. The gel must be run long enough to have good separation of the ladder.  The gel image must be provided at the time of submission.
  • Products do not need to be cleaned up prior to submission.  However, if primer dimers or off-target products are generated, then products should be cleaned up to remove these products and/or the primary PCR reaction should be optimized.
  • Submit samples in a 96-well PCR-type plate, filled by column, starting with A1.