Sample Requirements for Illumina Sequencing

The quantities specified below apply to samples that have been quantified by a fluorometric method, such as Qubit or PicoGreen. The Genomics Core has a Qubit and FLUOstar OPTIMA microplate reader available to users for quantification.

If your samples do not meet the sample submission requirements, please contact the Genomics Core to discuss your specific situation.

User Prepared Library Requirements

Submit libraries in 10mM Tris, 0.1% Tween20, Qiagen EB buffer, or nuclease-free water. Submit libraries in 1.5 ml microcentrifuge tube, tightly sealed and clearly labelled. LIMS ID must be written on the sides of all tubes. 
Instrument Maximum Fragment Size Minimum Concentration Minimum Volume
HiSeq 4000 550 bp 10nM 15 µl
MiSeq 900 bp 10nM 15 µl

 

DNA Requirements for Whole Genome Shotgun Sequencing

Submit DNA in 10mM Tris pH 8.0, Qiagen EB buffer, or nuclease-free water. All DNA must be treated with RNase.  
Type Kit Quantity Concentration Minimum Volume Notes
Standard Genomic DNA Library Illumina TruSeq Nano DNA ≥ 500 ng preferred, 200 ng minimum ≥ 10 ng/µl 20 µl gDNA must be high molecular weight, gel image preferred to confirm the quality
Low Input DNA Library Rubicon ThruPLEX DNA-seq ≥ 50 ng preferred, 20 ng minimum ≥ 1 ng/µl 20 µl Greater than 10 ng of input DNA is recommended to achieve a highly diverse library.
ChIP-seq Library Rubicon ThruPLEX DNA-seq ≥ 50 ng preferred, 20 ng minimum ≥ 1 ng/µl 20 µl DNA fragment size must be < 450 bp.     Bioanalyzer trace must be provided to confirm size.
Mate Pair Library Nextera Mate Pair Library > 4 µg ≥ 20 ng/µl 50 µl High quality, high molecular weight gDNA required (the majority of DNA must be greater than 50 kb in size and have minimal lower molecular weight smearing). Gel image must be provided prior to submission for approval. Use a high molecular weight ladder such as, NEB's Quick-Load 1 kb Extend DNA Ladder, which has a 48.5 kb upper marker.

 

RNA Requirements

Submit RNA in nuclease-free water, 10mM Tris pH 8.0, or Qiagen EB buffer. All RNA must be treated with DNase. A bioanalyzer trace or equivalent (such as TapeStation) must be submitted with samples. RIN scores of 8.0 or greater are recommended. 
Type Kit Quantity Concentration Minimum Volume Notes
Strand-Specific mRNA Library Illumina TruSeq Stranded mRNA Library ≥ 2 µg total RNA preferred, 1 µg total RNA minimum ≥ 50 ng/µl 20 µl For sequencing of poly-adenylated mRNA. Appropriate for high quality, eukaryotic RNA samples.
Ribo-depleted RNA-seq Library Illumina TruSeq Stranded Total Library with RiboZero rRNA Depletion ≥ 2 µg total RNA preferred, 1 µg total RNA minimum ≥ 50 ng/µl 20 µl May be used for bacterial RNA, low-quality (e.g. degraded) eukaryotic RNA, or when you wish to capture ncRNA along with mRNA. Library prep kits are species-specific, please check with Genomics Core staff for available options.
MicroRNA Library Illumina TruSeq Small RNA Library ≥ 2 µg total RNA preferred, 1 µg total RNA minimum ≥ 250 ng/µl 15 µl For sequencing of microRNA between 22 and 30nt.
Small RNA Library Illumina TruSeq Small RNA Library ≥ 2 µg total RNA preferred, 1 µg total RNA minimum ≥ 250 ng/µl 15 µl Contact Genomics Core to discuss sequencing of small RNAs > 30nt.

 

Amplicon/Metagenomics Requirements

The table below provides an overview of the submission requirements for 16S-V4/16S-V3V4 and all other amplicons. More instructions are provided below the table. 
Region of Interest Input Concentration Minimum Volume Multiplex Notes
16S-V4 Genomic DNA 1 ng/µl minimum 10 µl up to 576 samples (dual-indexes) Test amplification and gel image required, see below for more details.
16S-V3V4 Genomic DNA 1 ng/µl minimum 10 µl up to 96 samples (single indexes) Test amplification and gel image required, see below for more details.
Other Primary PCR product 1 ng/µl minimum 10 µl up to 576 samples (dual-indexes) Gel image required, see below for more details.

 

16S-V4 and 16S-V3V4 Amplicons

The library preparation for the 16S-V4 and 16S-V3V4 regions employ a one-step PCR method.  The Genomics Core will use 1 µl of genomic DNA for the amplicon preparation.

The submitter is required to:

  • Quantify samples via Qubit or PicoGreen (or other fluorometric method) and normalize all samples to the same concentration.
  • Perform a test amplification using the target-specific primers to confirm the sample can be amplified and that the product is the expected size. The gel image must be provided at the time of submission.
  • Submit samples in a 96-well PCR-type plate, filled by column, starting with well A1.

Primers for test amplification:

16S V4 forward (515f): GTGCCAGCMGCCGCGGTAA
16S V4 reverse (806r): GGACTACHVGGGTWTCTAAT

 

Other Amplicons (index adapters added by MSU Genomics Core)

For all other amplicon sequencing, a two-step PCR approach is used.  The first PCR uses target-specific primers with tags on the 5’ ends that allow us to do a second PCR for barcoding.  The submitter is required to perform the primary PCR reaction.  To do this, submitter's will need to order primers with the following tags on the 5’ ends, with the target-specific forward and reverse sequences inserted in [TS-For] and [TS-Rev], respectively:

CS1-TS-F: 5’- ACACTGACGACATGGTTCTACA – [TS-For] – 3’
CS2-TS-R:   5’- TACGGTAGCAGAGACTTGGTCT – [TS-Rev] – 3’

The Genomics Core will use 1 µl of primary PCR product for the amplicon preparation.

The submitter is required to:

  • Quantify products via Qubit or PicoGreen (or other fluorometric method) and normalize all products to the same concentration.
  • Run products on a gel to confirm the amplification was successful and that the products are the expected size. The gel image must be provided at the time of submission.
  • Submit samples in a 96-well PCR-type plate, filled by column, starting with well A1.
  • Products do not need to be cleaned up prior to submission.