Toggle Accessibility Tools

Amplicon/Metagenomic Guide

Overview

This webpage provides details, recommendations, and requirements for the amplicon library preparation services offered by the MSU Genomics Core.  The table below provides an overview of the submission requirements for 16S-V4, 16S-V3V4, and all other amplicons.  Additional requirements, PCR recipes, and cycling conditions are provided below the table.  A PDF of this webpage is also available for download.

16S-V4 Amplicons
16S-V3V4 Amplicons
Other Amplicons
References


 
Target Input Concentration Minimum Volume Multiplex Notes
16S-V4 Metagenomic DNA 1 ng/µl minimum 10 µl up to 576 samples (dual-indexes) Test amplification and gel image required, see below for more details.
16S-V3V4 Metagenomic DNA 1 ng/µl minimum 10 µl up to 96 samples (single indexes) Test amplification and gel image required, see below for more details.
Other Primary PCR product 1 ng/µl minimum 10 µl up to 576 samples (dual-indexes) Gel image required, see below for more details.

16S-V4 Amplicons

The library preparation for the 16S-V4 region employs a one-step PCR method using the primer pair 515f/806r:

16S V4 forward (515f): GTGCCAGCMGCCGCGGTAA
16S V4 reverse (806r): GGACTACHVGGGTWTCTAAT

Kozich, J. J., Westcott, S. L., Baxter, N. T., Highlander, S. K. & Schloss, P. D. Development of a dual-index sequencing strategy and curation pipeline for analyzing amplicon sequence data on the MiSeq Illumina sequencing platform. Applied and environmental microbiology 79, 5112–5120 (2013) (https://github.com/SchlossLab/MiSeq_WetLab_SOP/blob/master/MiSeq_WetLab_SOP.md)

The submitter is required to:

  • Quantify samples via fluorometric method (such as Qubit or PicoGreen) and normalize all samples to approximately the same concentration.
  • Perform a test amplification using the 16S-V4 primers (above) to confirm the sample can be amplified and that the product is the expected size. A ladder must be run alongside the samples so that the PCR products can be sized. The gel must be run long enough to have good separation of the ladder.  The gel image(s) must be provided at the time of submission. 
  • Submit samples in a 96-well PCR-type plate, filled by column, starting with A1.

The Genomics Core will use 1 µl of genomic DNA for the amplicon library preparation.  Therefore, it is recommended that test amplifications be performed using a protocol similar to the Genomics Core's amplicon library preparation protocol:

16S-V4 recipe and cycling conditions

 

 

 

 

 

 

 

 


16S-V3V4 Amplicons

The library preparation for the 16S-V3V4 region employs a one-step PCR method using the primer pair 341f/806r:

16S V3 forward (341f): CCTACGGGAGGCAGCAG
16S V4 reverse (806r): GGACTACHVGGGTWTCTAAT

Caporaso, J. G. et al. Global patterns of 16S rRNA diversity at a depth of millions of sequences per sample. Proceedings of the National Academy of Sciences 108 Suppl 1, 4516–4522 (2011)*

*The Genomics Core uses a modification of this protocol, substituting the 341f primer in place of the 515f primer.

The submitter is required to:

  • Quantify samples via fluorometric method (such as Qubit or PicoGreen) and normalize all samples to approximately the same concentration.
  • Perform a test amplification using the 16S-V3V4 primers (above) to confirm the sample can be amplified and that the product is the expected size. A ladder must be run alongside the samples so that the PCR products can be sized. The gel must be run long enough to have good separation of the ladder.  The gel image(s) must be provided at the time of submission. 
  • Submit samples in a 96-well PCR-type plate, filled by column, starting with A1.

The Genomics Core will use 1 µl of genomic DNA for the amplicon library preparation.  Therefore, it is recommended that test amplifications be performed using a protocol similar to the Genomics Core's amplicon library preparation protocol:

16S-V3V4 recipe and cycling conditions

 

 

 

 

 

 

 

 


OTHER AMPLICONS (INDEX ADAPTERS ADDED BY MSU GENOMICS CORE)

For all other amplicon sequencing, a two-step PCR approach is used.  The first PCR uses target-specific primers with tags on the 5’ ends that allow the Genomics Core to do a second PCR for barcoding.  The submitter is required to perform the primary PCR reaction.  To do this, the submitter will need to order primers with the following tags on the 5’ ends, with the target-specific forward and reverse sequences inserted in [TS-For] and [TS-Rev], respectively:

CS1-TS-F: 5’ – ACACTGACGACATGGTTCTACA – [TS-For] – 3’
CS2-TS-R: 5’ – TACGGTAGCAGAGACTTGGTCT – [TS-Rev] – 3’

When choosing primers for a targeted amplicon it is recommended that the product amplified is less than 400bp (not including the 44bp added by the CS1/CS2 overhangs). This size will permit adequate overlap of the forward and reverse read 3' ends when sequencing with a 2x250bp format.

The Genomics Core will use 1 µl of primary PCR product for the amplicon indexing.

The submitter is required to:

  • Quantify samples via fluorometric method (such as Qubit or PicoGreen) and normalize all samples to approximately the same concentration.
  • Run products on a gel to confirm the amplification was successful, the products are the expected size, and that off-target products (including primer-dimer) are not present. The gel image must be provided at the time of submission.
  • Products do not need to be cleaned up prior to submission.  However, if primer dimers or off-target products are generated, then products should be cleaned up to remove these products and/or the primary PCR reaction should be optimized.
  • Submit samples in a 96-well PCR-type plate, filled by column, starting with A1

References

Kozich, J. J. et al. Development of a dual-index sequencing strategy and curation pipeline for analyzing amplicon sequence data on the MiSeq Illumina sequencing platform. Applied and environmental microbiology 79, 5112–5120 (2013).

Caporaso, J. G. et al. Global patterns of 16S rRNA diversity at a depth of millions of sequences per sample. Proceedings of the National Academy of Sciences 108 Suppl 1, 4516–4522 (2011)

Klindworth, A. et al. Evaluation of general 16S ribosomal RNA gene PCR primers for classical and next-generation sequencing-based diversity studies. Nucleic Acids Res 41, e1–e1 (2013).