Sanger Sequencing Standard Primers

 

The following are available for high-throughput sequencing at no additional charge. Before using please verify that your vector has the complimentary primer site. When submitting your samples identify the primer you wish to use by the appropriate primer name:

 

Primer Name Sequence (5' to 3')
M13 Forward TGTAAAACGACGGCCAGT
M13 Reverse CAGGAAACAGCTATGACC
SP6 ATTTAGGTGACACTATAG
T7 TAATACGACTCACTATAGGG
T7 terminator GCTAGTTATTGCTCAGCGG
T3 ATTAACCCTCACTAAAGGGA